IthaID: 238
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 114 (-CT, +G) >156aa | HGVS Name: | HBB:c.343_344delinsG |
| Hb Name: | Hb Geneva | Protein Info: | β 114 (-CT); modified C-terminal sequence AND β 114(+G); modified C-terminal sequence |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCTGGGCAACGTGCTGGTCTGTGTG [CT/G] GGCCCATCACTTTGGCAAAGAATTC (Strand: -)
Comments: Inclusion body beta-thalassemia characterized in a heterozygote by moderate anemia, severe red cell abnormalities, splenomegaly, inclusion body formation, elevated Hb A2 levels, and an increased in vitro α/β chain synthetic ratio.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
| Allele Phenotype: | Thalassaemia dominant Dominant |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71917 |
| Size: | 2 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Swiss-French, Swiss |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Beris P, Miescher PA, Diaz-Chico JC, Han IS, Kutlar A, Hu H, Wilson JB, Huisman TH, Inclusion body beta-thalassemia trait in a Swiss family is caused by an abnormal hemoglobin (Geneva) with an altered and extended beta chain carboxy-terminus due to a modification in codon beta 114., Blood, 72(2), 801-5, 1988
Created on 2010-06-16 16:13:15,
Last reviewed on 2023-08-09 10:21:52 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.