IthaID: 2463
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | TTS +99 C>C | HGVS Name: | HBB:c.*233G>C |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
TGAAGAGCTAGTTCAAACCTT [C/G] GGAAAATACACTATATCTTAAA (Strand: -)
Also known as:
Comments: This variant was described in a cohort of Palestinians with β-thal trait or disease as a possible β+ allele [PMID: 23321370]. Nevertheless, a subsequent study investigating 18 individuals with the HBB:c.*233G>C variant gave no evidence for pathogenicity, strongly suggesting that it is not associated with a β-thal phenotype [PMID: 26524961].
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β+ |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 72251 |
Size: | 1 bp |
Located at: | β |
Specific Location: | 3'UTR |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Other 3'UTR site (mRNA Processing) |
Ethnic Origin: | Palestinian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Sirdah MM, Sievertsen J, Al-Yazji MS, Tarazi IS, Al-Haddad RM, Horstmann RD, Timmann C, The spectrum of β-thalassemia mutations in Gaza Strip, Palestine., Blood Cells Mol. Dis. , 50(4), 247-51, 2013 PubMed
- Smith DL, Mitui M, Park JY, Luu HS, Timmons CF, Characterization of the HBB: c.*233G > C Variant: No Evidence of a β-Thalassemic Phenotype., Hemoglobin , 40(1), 25-8, 2016 PubMed
Created on 2014-06-03 15:35:00,
Last reviewed on 2021-02-12 15:25:04 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2014-06-03 15:35:00 | The IthaGenes Curation Team | Created |
2 | 2018-08-06 19:18:29 | The IthaGenes Curation Team | Reviewed. Ethnic origin corrected. Mutation comment, dbSNP link and Reference added. |
3 | 2018-08-07 11:16:38 | The IthaGenes Curation Team | Reviewed. Text edits. |
4 | 2021-02-12 14:58:24 | The IthaGenes Curation Team | Reviewed. HGVS and common name corrected. |
5 | 2021-02-12 15:25:04 | The IthaGenes Curation Team | Reviewed. Chromosome location corrected. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2023-03-21 11:16:02