IthaID: 2539

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS II-3 (+21bp) HGVS Name: HBA1:c.283_300+3dup
Hb Name: Hb SKMC Protein Info: α1 nt 437 - α1 nt 457 inserted between nts 454 and 455 of α1
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TCAACTTCAAGGTG [-/GACCCGGTCAACTTCAAGGTG] AGCGGCGGGCCGG (Strand: +)

Comments: The heterozygous form of the insertion produces small amount of unstable haemoglobin (Hb) with no specific effect on Hb level and RBC indices, but double heterozygote with other trait presenting mutations can increase unstable Hb production in a manner that presents with severe anemia.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-thalassaemia, α-chain variant
Allele Phenotype:α⁺
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37979
Size: 21 bp
Located at: α1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Iranian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Waye JS, Eng B, Patterson M, Carcao MD, Chang L, Olivieri NF, Chui DH, Identification of two new alpha-thalassemia mutations in exon 2 of the alpha1-globin gene., Hemoglobin, 25(4), 391-6, 2001
  2. Farashi S, Faramarzi Garous N, Zeinali F, Vakili S, Ashki M, Imanian H, Najmabadi H, Azarkeivan A, Tamaddoni A, A 21 Nucleotide Duplication on the α1- and α2-Globin Genes Involves a Variety of Hypochromic Microcytic Anemias, From Mild to Hb H Disease., Hemoglobin , 39(3), 196-200, 2015
  3. Zekavat OR, Dehghani SJ, Imanifard J, Dehbozorgian J, Zareifar S, Haghpanah S, Introduction of novel α1-hemoglobin gene mutation with transfusion-dependent phenotype., Hematology , 2016
Created on 2015-01-08 16:05:41, Last reviewed on 2021-10-21 15:54:38 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.