
IthaID: 256
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 127/128 -AGG [Glu-Ala>Pro] | HGVS Name: | HBB:c.383_385delAGG |
Hb Name: | Hb Gunma | Protein Info: | β 127(H5) - 128(H6) Gln-Ala->0 AND inserted Pro |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGCAAAGAATTCACCCCACCAGTGC [-/AGG] CTGCCTATCAGAAAGTGGTGGCTGG (Strand: -)
Phenotype
Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
Allele Phenotype: | Thalassaemia dominant Dominant |
Stability: | Unstable |
Oxygen Affinity: | N/A |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 71957 |
Size: | 3 bp |
Located at: | β |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Japanese |
Molecular mechanism: | Altered α1β1 interface |
Inheritance: | Dominant |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Hattori Y, Yamane A, Yamashiro Y, Matsuno Y, Yamamoto K, Yamamoto K, Ohba Y, Miyaji T, Characterization of beta-thalassemia mutations among the Japanese., Hemoglobin, 13(7), 657-70, 1989
- Fucharoen S, Fucharoen G, Fukumaki Y, Nakayama Y, Hattori Y, Yamamoto K, Ohba Y, Three-base deletion in exon 3 of the beta-globin gene produced a novel variant (beta gunma) with a thalassemia-like phenotype., Blood, 76(9), 1894-6, 1990
- Ohba Y, Hattori Y, Harano T, Harano K, Fukumaki Y, Ideguchi H, beta-thalassemia mutations in Japanese and Koreans., Hemoglobin, 21(2), 191-200, 1997
Created on 2010-06-16 16:13:15,
Last reviewed on 2014-04-30 09:27:38 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.