IthaID: 2575



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 58 +C HGVS Name: HBD:c.176_177insC
Hb Name: N/A Protein Info: δ 58(E2) (+C) modified C-terminal sequence

Context nucleotide sequence:
CCTCTCCTGATGCTGTTATGGGCAACC [-/C] CTAAGGTGAAGGCTCATGGCAAGA (Strand: -)

Also known as:

Comments: Found in a male in compound heterozygote HPFH-2 and HBD:c.176_177insC, p.Lys60* (Cd58(+C)). No HbA2 detected in this case suggestive of δ-thalassaemic effect. The frameshift (+C) insertion modifies the C-terminal sequence and leads to a premature stop codon that prevents any expression of the mutated HBD allele.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: δ-thalassaemia
Allele Phenotype:δ0
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 63486
Size: 1 bp
Located at: δ
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1L. Harteveld, Cornelis2016-03-02First report.
Created on 2016-05-06 14:20:23, Last reviewed on 2016-08-24 13:34:34 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.