IthaID: 267

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: 3'UTR +6 C>G HGVS Name: HBB:c.*6C>G
Hb Name: N/A Protein Info: N/A
Also known as: Terminal CD +6 C>G, CAP +1480, β nt 1480 C>G

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TGGCCCACAAGTATCACTAAGCTCG [C/G] TTTCTTGCTGTCCAATTTCTATTAA (Strand: -)

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
β++ (silent)
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72024
Size: 1 bp
Located at: β
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Other 3'UTR site (mRNA Processing)
Ethnic Origin: Greek
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Jankovic L, Dimovski AJ, Kollia P, Karageorga M, Loukopoulos D, Huisman TH, A C----G mutation at nt position 6 3' to the terminating codon may be the cause of a silent beta-thalassemia., International journal of hematology, 54(4), 289-93, 1991
  2. Maragoudaki E, Vrettou C, Kanavakis E, Traeger-Synodinos J, Metaxotou-Mavrommati A, Kattamis C, Molecular, haematological and clinical studies of a silent beta-gene C-->G mutation at 6 bp 3' to the termination codon (+1480 C-->G) in twelve Greek families., British journal of haematology, 103(1), 45-51, 1998
Created on 2010-06-16 16:13:15, Last reviewed on 2022-05-17 16:07:58 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.