
IthaID: 268
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Variant of Uncertain Significance |
|---|---|---|---|
| Common Name: | 3'UTR +47 C>G | HGVS Name: | HBB:c.*47C>G |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: | Terminal CD +47 C>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TTTCTATTAAAGGTTCCTTTGTTCC [C/G] CTATTAAAGGTTCCTTTGTTCCTAT (Strand: -)
Comments: Found in a Middle Eastern (Armenian) case in compound heterozygosity with IVS I-130 G>C [IthaID:118], presented with mild β-Thalassaemia intermedia phenotype.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β++ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72065 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | 3'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Other 3'UTR site (mRNA Processing) |
| Ethnic Origin: | Armenian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Ho PJ, Hall GW, Luo LY, Weatherall DJ, Thein SL, Beta-thalassaemia intermedia: is it possible consistently to predict phenotype from genotype?, Br J Haematol, 100(1), 70-8, 1998
- Thein SL, Beta-thalassaemia., Baillieres Clin Haematol, 11(1), 91-126, 1998
Created on 2010-06-16 16:13:15,
Last reviewed on 2022-05-17 16:15:18 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.