IthaID: 29

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: -28 (A>G) HGVS Name: HBB:c.-78A>G
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
AGGGCAGGAGCCAGGGCTGGGCATA [A>G] AAGTCAGGGCAGAGCCATCTATTGC (Strand: -)

Comments: Genotype-phenotype association studies identified this variant as a contributor to γ-globin reactivation, a finding further validated in HUDEP-2 and CD34⁺ cells. Functionally, the variant was shown to disrupt TBP binding sites in the adult HBB promoter TATA box, thereby enhancing interactions between the LCR and HBG promoters.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]
Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70517
Size: 1 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: African-American, Southeast Asians
Molecular mechanism: TATAA box (HBB)
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Orkin SH, Sexton JP, Cheng TC, Goff SC, Giardina PJ, Lee JI, Kazazian HH, ATA box transcription mutation in beta-thalassemia., Nucleic acids research, 11(14), 4727-34, 1983
  2. Lou JW, Li Q, Wei XF, Huang JW, Xu XM, Identification of the linkage of a 1.357 KB beta-globin gene deletion and A gamma-globin gene triplication in a Chinese family., Hemoglobin, 34(4), 343-53, 2010
  3. Song M, Wei X, Luo H, Wang J, Ye Y, Qin L, Niu C, Long Y, Wang X, Shao C, Yu M, Gu F, Zhang X, Xu X, A common TBP-binding site mutation elevates γ-globin levels by competitive globin switching change in β-thalassemia., Blood Adv, 2025
Created on 2010-06-16 16:13:14, Last reviewed on 2025-05-05 08:56:09 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.