
IthaID: 29
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | -28 (A>G) | HGVS Name: | HBB:c.-78A>G |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AGGGCAGGAGCCAGGGCTGGGCATA [A>G] AAGTCAGGGCAGAGCCATCTATTGC (Strand: -)
Comments: Genotype-phenotype association studies identified this variant as a contributor to γ-globin reactivation, a finding further validated in HUDEP-2 and CD34⁺ cells. Functionally, the variant was shown to disrupt TBP binding sites in the adult HBB promoter TATA box, thereby enhancing interactions between the LCR and HBG promoters.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β+ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70517 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | African-American, Southeast Asians |
| Molecular mechanism: | TATAA box (HBB) |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Orkin SH, Sexton JP, Cheng TC, Goff SC, Giardina PJ, Lee JI, Kazazian HH, ATA box transcription mutation in beta-thalassemia., Nucleic acids research, 11(14), 4727-34, 1983
- Lou JW, Li Q, Wei XF, Huang JW, Xu XM, Identification of the linkage of a 1.357 KB beta-globin gene deletion and A gamma-globin gene triplication in a Chinese family., Hemoglobin, 34(4), 343-53, 2010
- Song M, Wei X, Luo H, Wang J, Ye Y, Qin L, Niu C, Long Y, Wang X, Shao C, Yu M, Gu F, Zhang X, Xu X, A common TBP-binding site mutation elevates γ-globin levels by competitive globin switching change in β-thalassemia., Blood Adv, 2025
Created on 2010-06-16 16:13:14,
Last reviewed on 2025-05-05 08:56:09 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.