IthaID: 3066
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Benign / Likely Benign |
---|---|---|---|
Common Name: | IVS I-108 T>C | HGVS Name: | HBB:c.93-23T>C |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GATAGGCACTGACTCTCTCTGCCTA [C>T] TGGTCTATTTTCCCACCCTTAGGCT (Strand: -)
Also known as:
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | Unclear |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70794 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Cryptic splice site (mRNA Processing) |
Ethnic Origin: | Iranian, European, Cuban |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Badens C, Jassim N, Martini N, Mattei JF, Elion J, Lena-Russo D, Characterization of a new polymorphism, IVS-I-108 (T-->C), and a new beta-thalassemia mutation, -27 (A-->T), discovered in the course of a prenatal diagnosis., Hemoglobin, 23(4), 339-44, 1999 PubMed
- Muñiz A, Martinez G, Lavinha J, Pacheco P, Beta-thalassaemia in Cubans: novel allele increases the genetic diversity at the HBB locus in the Caribbean., Am. J. Hematol. , 64(1), 7-14, 2000 PubMed
- Boussiou M, Karababa P, Sinopoulou K, Tsaftaridis P, Plata E, Loutradi-Anagnostou A, The molecular heterogeneity of beta-thalassemia in Greece., Blood Cells Mol. Dis. , 40(3), 317-9, 2008 PubMed
- Vinciguerra M, Cassarà F, Cannata M, Renda D, Calvaruso G, Leto F, Passarello C, Maggio A, Giambona A, Phenotypic evaluations of HBB:c.93-23T>C, a nucleotide substitution in the IVS I nt 108 of β-globin gene., J. Clin. Pathol. , 2017 PubMed
Created on 2016-09-06 13:05:38,
Last reviewed on 2022-10-21 09:45:17 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-09-06 13:05:38 | The IthaGenes Curation Team | Created |
2 | 2017-09-06 11:13:54 | The IthaGenes Curation Team | Reviewed. Functionality corrected. New references added. |
3 | 2022-10-21 09:45:17 | The IthaGenes Curation Team | Reviewed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2023-03-22 16:46:31