IthaID: 3077



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Variant of Uncertain Significance
Common Name: -83 G>A HGVS Name: HBB:c.-133G>A
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CACCCTGTGGAGCCACACCCTA [G>A] GGTTGGCCAATCTACTCCCAGG (Strand: -)

Comments: The -83 mutation is located several nucleotides 3’ of the CACCC box (positions -90 to -86) in the β globin gene promoter. Found in a heterozygous state together with a common heterozygous deletional α-thal mutation (-α3.7) in an adult male from Gabon presenting with mild microcytic anaemia (Hb 12.3 g/dL, MCV 76.4 fL, MCH 25.5 pg, normal Hb pattern, 3.5% Hb A2 and 0.8% Hb F) [PMID: 19657844]. Found in a heterozygous state in a Tunisian female presenting with discrete microcytic anaemia (Hb 12 g/dL, MCV 82 fL, MCH 32.2 pg, MCHC 26.4 g/100 mL, 3.7% Hb A2 and <1% Hb F) [PMID: 25754248]. Found in a compound heterozygous state with the -29 A>G β+ thal mutation [ithaID=25] in two probands who had similar indices to carriers of the -29 mutation (F/M: Hb 12.3/13.5 g/dL, MCV 68.8/75.7 fL, MCH 22.8/24.3 pg, HbA2 5.5/5.5%, HbF 2.5/2.7 %). Found in a heterozygous state in a female without abnormal indices (Hb 97.2 g/dL, MCV 86.7 fL, MCH 29.2 pg, HbA2 2.8%) and in association with CD 8 (-AA) β0 thal mutation [ithaID=61] in her premature infant having only HbF and no detectable HbA (Hb 9.8 g/dL, MCV 83.8 fL, MCH 27.1 pg, HbA2 nd%, HbF 91.2%). Found in trans with the HbS mutation in a mother (HbA 55%, HbS 38.8%) and her premature child (HbA 10.8%, HbS 9.1%), both presenting with the phenotype of Hb S trait rather than Hb S/ β+ thal. Cases are all of African or Mediterranean descent [PMID: 25405919]. Current evidence is indicative of a variant of uncertain significance.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:Unclear
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70462
Size: 1 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Tunisian, Gabonese, African, Mediterranean
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Cadet E, Foulon K, Claisse JF, Rochette J, First identification of a point mutation at position -83 (G>A) of the beta-globin gene promoter., Hemoglobin, 33(3), 274-8, 2009 PubMed
  2. Waye JS, Eng B, Hanna M, Hohenadel BA, Nakamura LN, Walker L, Non-thalassemic phenotype associated with the -83 (G > A) mutation of the β-globin gene promoter (HBB: c.-133G > A)., Hemoglobin, 38(6), 447-8, 2014 PubMed
  3. Douzi K, Moumni I, Zorai A, Ben Mustapha M, Ben Mansour IM, Dorra C, Salem A, Two new β+ -thalassemia mutation [β -56 (G → C); HBBc. -106 G → C] and [β -83 (G → A); HBBc. -133 G → A] described among the Tunisian population., Am. J. Hum. Biol. , 27(5), 716-9, 2015 PubMed
Created on 2016-09-08 19:22:20, Last reviewed on 2023-12-21 08:52:58 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.