IthaID: 3077
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Variant of Uncertain Significance |
---|---|---|---|
Common Name: | -83 G>A | HGVS Name: | HBB:c.-133G>A |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CACCCTGTGGAGCCACACCCTA [G>A] GGTTGGCCAATCTACTCCCAGG (Strand: -)
Also known as:
Comments: The -83 mutation is located several nucleotides 3’ of the CACCC box (positions -90 to -86) in the β globin gene promoter. Found in a heterozygous state together with a common heterozygous deletional α-thal mutation (-α3.7) in an adult male from Gabon presenting with mild microcytic anaemia (Hb 12.3 g/dL, MCV 76.4 fL, MCH 25.5 pg, normal Hb pattern, 3.5% Hb A2 and 0.8% Hb F) [PMID: 19657844]. Found in a heterozygous state in a Tunisian female presenting with discrete microcytic anaemia (Hb 12 g/dL, MCV 82 fL, MCH 32.2 pg, MCHC 26.4 g/100 mL, 3.7% Hb A2 and <1% Hb F) [PMID: 25754248]. Found in a compound heterozygous state with the -29 A>G β+ thal mutation [ithaID=25] in two probands who had similar indices to carriers of the -29 mutation (F/M: Hb 12.3/13.5 g/dL, MCV 68.8/75.7 fL, MCH 22.8/24.3 pg, HbA2 5.5/5.5%, HbF 2.5/2.7 %). Found in a heterozygous state in a female without abnormal indices (Hb 97.2 g/dL, MCV 86.7 fL, MCH 29.2 pg, HbA2 2.8%) and in association with CD 8 (-AA) β0 thal mutation [ithaID=61] in her premature infant having only HbF and no detectable HbA (Hb 9.8 g/dL, MCV 83.8 fL, MCH 27.1 pg, HbA2 nd%, HbF 91.2%). Found in trans with the HbS mutation in a mother (HbA 55%, HbS 38.8%) and her premature child (HbA 10.8%, HbS 9.1%), both presenting with the phenotype of Hb S trait rather than Hb S/ β+ thal. Cases are all of African or Mediterranean descent [PMID: 25405919]. Current evidence is indicative of a variant of uncertain significance.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | Unclear |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70462 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Promoter |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Promoter (Transcription) |
Ethnic Origin: | Tunisian, Gabonese, African, Mediterranean |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Cadet E, Foulon K, Claisse JF, Rochette J, First identification of a point mutation at position -83 (G>A) of the beta-globin gene promoter., Hemoglobin, 33(3), 274-8, 2009 PubMed
- Waye JS, Eng B, Hanna M, Hohenadel BA, Nakamura LN, Walker L, Non-thalassemic phenotype associated with the -83 (G > A) mutation of the β-globin gene promoter (HBB: c.-133G > A)., Hemoglobin, 38(6), 447-8, 2014 PubMed
- Douzi K, Moumni I, Zorai A, Ben Mustapha M, Ben Mansour IM, Dorra C, Salem A, Two new β+ -thalassemia mutation [β -56 (G → C); HBBc. -106 G → C] and [β -83 (G → A); HBBc. -133 G → A] described among the Tunisian population., Am. J. Hum. Biol. , 27(5), 716-9, 2015 PubMed
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-09-08 19:22:20 | The IthaGenes Curation Team | Created |
2 | 2019-08-09 09:46:04 | The IthaGenes Curation Team | Reviewed. Reference added. |
3 | 2020-03-10 12:41:52 | The IthaGenes Curation Team | Reviewed. Allele context sequence, Comment, Ethnic origin and Reference added. Allele phenotype corrected. |
4 | 2020-03-11 10:37:51 | The IthaGenes Curation Team | Reviewed. Allele phenotype updated. |