IthaID: 3180



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Benign / Likely Benign
Common Name: 3'UTR +62 A>G HGVS Name: HBB:c.*62A>G
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CCTTTGTTCCCTAAGTCCAACTACT [A/G] AACTGGGGGATATTATGAAGGGCC (Strand: -)

Comments: Found during a routine molecular analysis. Based on the normal hematology and clinical expression in the mother and child (both carriers for the novel single nucleotide variant), the mutation is likely non-pathogenic.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72080
Size: 1 bp
Located at: β
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Other 3'UTR site (mRNA Processing)
Ethnic Origin: Middle East, Turkish
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Arpaci A, Gul BU, Ozcan O, Ilhan G, El C, Dirican E, Elmacioglu S, Kaya H, Presentation of two new mutations in the 3'untranslated region of the β-globin gene and evaluating the molecular spectrum of thalassemia mutations in the Mediterranean region of Turkey., Ann Hematol, 100(6), 1429-1438, 2021 PubMed

Microattributions

A/AContributor(s)DateComments
1Traeger Synodinos, Jan2017-02-15First report.
Created on 2017-02-17 15:56:53, Last reviewed on 2022-07-13 10:33:54 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.