IthaID: 3345
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CAP +22 (G>T) | HGVS Name: | HBB:c.-29G>T |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GCTTACATTTGCTTCTGACACAACT [T>G] TGTTCACTAGCAACCTCAAACAGAC (Strand: -)
Also known as:
Comments: Silent β-globin mutation found in a heterozygous state and in compound heterozygosity with the β0-thalassaemic allele HBB:c.92+1G>A [ithaID=101]. Following a pregnancy, the combination of the two alleles led to severe anemia with thansfusion-dependent β-thalassaemia intermedia phenotype.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β++ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70566 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | 5'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | 5'UTR (Transcription) |
| Ethnic Origin: | Italian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Vinciguerra M, Passarello C, Cassarà F, Leto F, Cannata M, Calvaruso G, Renda D, Maggio A, Giambona A, Coheredity of a new silent mutation: c.-29G>T, with a severe β-thal mutation in a patient with β-thalassemia intermediate., Int J Lab Hematol, 40(2), e17-e20, 2018
Created on 2019-03-26 16:45:09,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.