IthaID: 3400
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 147 TAA>CAA [Stop>Gln] | HGVS Name: | HBB:c.442T>C |
| Hb Name: | Hb Zunyi | Protein Info: | β 147, Stop>Gln; modified C-terminal sequence: (147)Gln-Ala-Arg-Phe-Leu-Ala-Val-Gln-Phe-Leu-Leu- Lys-Val-Pro-Leu-Phe-Pro-Lys-Ser-Asn-(167)Tyr-COOH |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CTAATGCCCTGGCCCACAAGTATCAC [T/C] AAGCTCGCTTTCTTGCTGTCCAA (Strand: -)
Comments: Reported as a de novo mutation in a young transfusion-dependent patient with severe hemolytic anaemia. This mutation results in a stop-codon substitution to a glutamine residue and an increase of 21 amino-acids in the beta-globin chain. Leads to a dominant beta-thalassemia state according to this case report.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
| Allele Phenotype: | Dominant |
| Stability: | Hyperunstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72016 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Nonsense codon (Translation) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Su Q, Chen S, Wu L, Tian R, Yang X, Huang X, Chen Y, Peng Z, Chen J, Severe Thalassemia Caused by Hb Zunyi [β147(HC3)Stop→Gln; : c.442T>C)] on the β-Globin Gene., Hemoglobin, 43(1), 7-11, 2019 PubMed
Created on 2019-04-11 16:33:29,
Last reviewed on 2023-07-03 15:36:03 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.