IthaID: 3443
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Variant of Uncertain Significance |
|---|---|---|---|
| Common Name: | Cap +1570 (T>C) | HGVS Name: | HBB:c.*96T>C |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGGATATTATGAAGGGCCTTGAGCATC [T>C] GGATTCTGCCTAATAAAAAACATTTATT (Strand: -)
Comments: The mutation is located 12 nucleotides upstream of the polyadenylation signal in the 3' UTR of the β-globin gene. In heterozygous carriers, the mutation causes a silent phenotype, while in compound heterozygosity with severe beta-thal mutations, it leads to a beta-thal intermedia state.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β++ (silent) |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72114 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | 3'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Other 3'UTR site (mRNA Processing) |
| Ethnic Origin: | Czech, Greek, Turkish, Italian, Irish |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Cai SP, Eng B, Francombe WH, Olivieri NF, Kendall AG, Waye JS, Chui DH, Two novel beta-thalassemia mutations in the 5' and 3' noncoding regions of the beta-globin gene., Blood, 79(5), 1342-6, 1992 PubMed
- Divoky V, Baysal E, Oner R, Cürük MA, Walker EL, Indrak K, Huisman TH, The T-->C mutation at position +96 of the untranslated region 3' to the terminating codon of the beta-globin gene is a rare polymorphism that does not cause a beta-thalassemia as previously ascribed., Hum. Genet., 93(1), 77-8, 1994 PubMed
- Bilgen T, Canatan D, Arıkan Y, Yeşilipek A, Keser İ, The effect of HBB: c.*+96T>C (3'UTR +1570 T>C) on the mild b-thalassemia intermedia phenotype., Turk J Haematol, 28(3), 219-22, 2011 PubMed
- Vinciguerra M, Passarello C, Cassarà F, Leto F, Cannata M, Calvaruso G, Di Maggio R, Renda D, Maggio A, Giambona A, Co-heredity of silent CAP + 1570 T>C (HBB:c*96T>C) defect and severe β-thal mutation: a cause of mild β-thalassemia intermedia., Int J Lab Hematol, 38(1), 17-26, 2016 PubMed
- Theodoridou S, Vyzantiadis TA, Vlachaki E, Compound Heterozygosity for Silent Cap +1570 (T>C) (HBB: c*96T>C), Codon 39 (C>T) (HBB: c.118C>T) and the Presence of ααα/αα in Greece. A Case Presentation., Hemoglobin, 42(3), 194-195, 2018 PubMed
Created on 2019-09-03 12:13:12,
Last reviewed on 2024-04-18 10:10:45 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.