IthaID: 3464



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CAP +3 A>T HGVS Name: HBB:c.-48A>T
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
AGGGCAGAGCCATCTATTGCTTAC [A>T] TTTGCTTCTGACACAACTGTGTT (Strand: -)

Also known as:

Comments: The nucleotide +3(A) from the CAP site is part of the initiator element (consensus sequence: Py-Py(C)-A+1-N-T/A-Py-Py) and an overlapping E-box (consensus sequence: CANNTG), possibly contributing to the efficient assembly of preinitiation complex on the β-globin gene. Co-inherited with 92+1G>A mutation in a case of β-thalassemia intermedia. Source: Romanian Biotechnological Letters, Vol. 16, No. 2, 2011

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++ (silent)
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70547
Size: 1 bp
Located at: β
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: 5'UTR (Transcription)
Ethnic Origin: Romanian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Agouti I, Bennani M, Nezri M, Levy N, Badens C, Beta-thalassemia intermedia due to two novel mutations in the promoter region of the beta-globin gene., Eur. J. Haematol. , 80(4), 346-50, 2008 PubMed
Created on 2019-09-27 11:55:33, Last reviewed on 2021-08-27 12:04:31 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.