IthaID: 3464
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CAP +3 A>T | HGVS Name: | HBB:c.-48A>T |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AGGGCAGAGCCATCTATTGCTTAC [A>T] TTTGCTTCTGACACAACTGTGTT (Strand: -)
Comments: The nucleotide +3(A) from the CAP site is part of the initiator element (consensus sequence: Py-Py(C)-A+1-N-T/A-Py-Py) and an overlapping E-box (consensus sequence: CANNTG), possibly contributing to the efficient assembly of preinitiation complex on the β-globin gene. Co-inherited with 92+1G>A mutation in a case of β-thalassemia intermedia. Source: Romanian Biotechnological Letters, Vol. 16, No. 2, 2011
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β++ (silent) |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70547 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | 5'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | 5'UTR (Transcription) |
| Ethnic Origin: | Romanian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Agouti I, Bennani M, Nezri M, Levy N, Badens C, Beta-thalassemia intermedia due to two novel mutations in the promoter region of the beta-globin gene., Eur. J. Haematol. , 80(4), 346-50, 2008 PubMed
Created on 2019-09-27 11:55:33,
Last reviewed on 2021-08-27 12:04:31 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.