IthaID: 3558
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | IVS II-821 (A>C) | HGVS Name: | HBB:c.316-30A>C |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AAGCTAGGCCCTTTTGCTAATC [A>C] TGTTCATACCTCTTATCTTCCT (Strand: -)
Comments: There are conflicting interpretations of pathogenicity for this variant. Data from contributors shows that carriers presented with normal haematological indices and also that co-inheritance of IVS II-821 (A>C) with α-variants does not cause more severe clinical symptoms than expected. In contrast, the variant was found in a Kurdish family [PMID: 31146650] where three siblings were carriers and presented with low haematological indices and abnormal HbA2 (around 5%). The father and one sibling had no mutations in the β-globin gene. No maternal information was provided. Bioinformatics analysis showed that this variant may influence normal splicing process.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71860 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Kurdish, Cypriot |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Azimi A, Nejati P, Tahmasebi S, Alimoradi S, Alibakhshi R, Characterization of the IVS-II-821 (A>C) (: c.316-30A>C) Mutation in a β-Thalassemia Phenotype in Iran., Hemoglobin, 43(1), 23-26, 2019 PubMed