
IthaID: 3563
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 126 GTG>-TG | HGVS Name: | HBB:c.379delG |
| Hb Name: | N/A | Protein Info: | p.Val127Cysfs*32 |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CTTTGGCAAAGAATTCACCCCACCA [-/G] TGCAGGCTGCCTATCAGAAAGTGGT (Strand: -)
Comments: Reported as a de novo mutation in a heterozygous carrier presenting with mild β-thalassaemia intermedia phenotype. Both his parents had normal β gene analysis. The proband had hemolytic anaemia with splenomegaly and his bone marrow showed erythroid hyperplasia and dyserythropoiesis resembling congenital dyserythropoietic anaemia (CDA). The loss of a nt G from codon 126 results in a frameshift and the elongation of the β-globin chain to 156 amino acids (157 aa is "TAA").
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | Dominant |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71953 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Turkish |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Gürlek-Gökçebay D, Akpinar-Tekgunduz S, Erdem HB, Yarali N, A Heterozygous Variant (: c.379delG, p.Val127Cysfs*32) Associated with a Mild β-Thalassemia Intermedia Phenotype in a Turkish Child., Hemoglobin, 43(0), 277-279, 2019
Created on 2020-01-31 12:46:24,
Last reviewed on 2020-01-31 12:47:49 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.