IthaID: 359



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS I-2 (-5 bp) GAGGTGAGG>GAGG----- donor HGVS Name: HBA2:c.95+2_95+6delTGAGG
Hb Name: N/A Protein Info: α2 nts 134-138 deleted
Also known as: α-5nt

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GTATGGTGCGGAGGCCCTGGAGAGG [-/TGAGG] CTCCCTCCCCTGCTCCGACCCGGGC (Strand: +)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33872
Size: 5 bp
Located at: α2
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Consensus splice site (mRNA Processing)
Ethnic Origin: Mediterranean, Middle East, Dutch, Moroccan
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Orkin SH, Goff SC, Hechtman RL, Mutation in an intervening sequence splice junction in man., Proceedings of the National Academy of Sciences of the United States of America, 78(8), 5041-5, 1981 PubMed
  2. Felber BK, Orkin SH, Hamer DH, Abnormal RNA splicing causes one form of alpha thalassemia., Cell , 29(3), 895-902, 1982 PubMed
  3. Harteveld KL, Heister AJ, Giordano PC, Losekoot M, Bernini LF, Rapid detection of point mutations and polymorphisms of the alpha-globin genes by DGGE and SSCA., Hum. Mutat. , 7(2), 114-22, 1996 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2026-03-09 09:33:12 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.