
IthaID: 3636
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 104 (-A) | HGVS Name: | HBB:c.313delA |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TGCACGTGGATCCTGAGAACTTC [A/-] GGGTGAGTCTATGGGACGCTTGA (Strand: -)
Comments: Found in a 12-year-old Chinese boy in compound heterozygosity with HBB:c.126_129delCTTT [IthaID:147] and the -α4.2 [IthaID:301]. Patient presented with severe β-thalassemia and required regular blood transfusions. The A deletion caused a frameshift at codon 104, which resulted in an elongated protein of 156 amino acid residues.
External Links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β+ |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 71037 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Chinese |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Qiu Y, Huang Y, Chen P, Wei S, Su Q, Zhang Z, Yang Z, Ye L, Huang J, Shen X, Mo W, Compound Heterozygosity for a Novel Mutation Codon 104 (-A) (: c.313delA) and Codons 41/42 (-CTTT) (: c.126_129delCTTT) Leading to β-Thalassemia Major in a Chinese Family., Hemoglobin, 2020
- Lin W, Zhang Q, Shen Z, Qu X, Wang Q, Wei L, Qiu Y, Yang J, Xu X, Lao J, Molecular and phenotype characterization of an elongated β-globin variant produced by HBB:C.313delA., Int J Lab Hematol, 43(6), 1620-1627, 2021
Microattributions
A/A | Contributor(s) | Date | Comments |
---|---|---|---|
1 | Qiu, Yuling | 2020-09-07 | First report. |
Created on 2020-10-02 09:39:52,
Last reviewed on 2021-12-22 15:22:14 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.