IthaID: 3692

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Variant of Uncertain Significance
Common Name: CD 35 (TAC>TA-) HGVS Name: HBB:c.108delC
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG [C/-] AAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGG (Strand: -)

Comments: Found in two Malay individuals presented with severe microcytosis (MCV: 63, 47.2 fL) and hypocromia (MCH: 19, 14.2 pg) and also with moderate anemia. Both patients showed elevated level of Hb A2 level (5.8, 5.1 %).

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70832
Size: 1 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Malay
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Zilfalil, Bin Alwi2020-10-20First report.
2Mohd Yasin, Norafiza 2020-10-20First report.
Created on 2020-10-27 14:31:19, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.