
IthaID: 381
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 62 (-GTG) [-Val] | HGVS Name: | HBA1:c.187_189del |
Hb Name: | Hb Aghia Sophia | Protein Info: | α1 62(E11) Val->0 |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCAGGTTAAGGGCCACGGCAAGAAG [GTG/-] GCCGACGCGCTGACCAACGCCGTGG (Strand: +)
Comments: The 3bp deletion is virtually silent in the heterozygote carrier and is revealed only by the interaction with an α0-thalassaemia haplotype.
Phenotype
Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia, α-chain variant |
Allele Phenotype: | α⁺ |
Stability: | N/A |
Oxygen Affinity: | N/A |
Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 37883 |
Size: | 3 bp |
Located at: | α1 |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
Ethnic Origin: | Greek |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Traeger-Synodinos J, Harteveld CL, Kanavakis E, Giordano PC, Kattamis C, Bernini LF, Hb Aghia Sophia [alpha62(E11)Val-->0 (alpha1)], an , Hemoglobin , 23(4), 317-24, 1999
Created on 2010-06-16 16:13:15,
Last reviewed on 2022-02-28 08:16:08 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.