
IthaID: 3896
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 132 (AAA>AA-) | HGVS Name: | HBB:c.399del |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CACCAGTGCAGGCTGCCTATCAGAA [A/-] GTGGTGGCTGGTGTGGCTAATGCCC (Strand: -)
Comments: Found as a de novo mutation causing dominant phenotype β-thalassaemia major, in a 3-year-old male presented with severe anaemia. The frameshift mutation delayed the termination of translation, resulting in an elongated β-globin variant, with an additional 10 amino acids.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71973 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Zhou X, Chen T, Zhang Q, Qi M, Zhang L, Du J, Chi H, Shen B, Xu X, Lu Y, De novo HBB frameshift mutation in a patient with dominant β-thalassemia major., Int J Lab Hematol, 44(1), e21-e25, 2022
Created on 2022-03-01 23:25:56,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.