
IthaID: 3927
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 128 GCT>-CT | HGVS Name: | HBB:c.385delG |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CAAAGAATTCACCCCACCAGTGCAG [G/-] CTGCCTATCAGAAAGTGGTGGCTGG (Strand: -)
Comments: Detected during thalassaemia screening in a Vietnamese cohort with microcytic hypochromic anemia.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71959 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Vietnamese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Xinh PT, Chuong HQ, Ha NTT, Tram HDB, Van Dong C, Thanh LVH, Hoa NTH, Nghia H, Binh NT, Dung PC, Vu HA, Spectrum of HBB gene mutations among 696 β-thalassemia patients and carriers in Southern Vietnam., Mol Biol Rep, 49(4), 2601-2606, 2022
Created on 2022-05-12 11:14:25,
Last reviewed on 2022-05-12 15:13:42 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.