|
Functionality:
|
Globin gene causative mutation |
Pathogenicity:
|
N/A |
|
Common Name:
|
-89 to -88 (-AC) |
HGVS Name:
|
HBB:c.-139_-138delAC |
|
Hb Name:
|
N/A |
Protein Info:
|
N/A |
|
Also known as:
|
|
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ACTTAGACCTCACCCTGTGGAGCCAC [AC/-] CCTAGGGTTGGCCAATCTACTCCCA (Strand: +)
Comments: Identified in a heterozygous state by NGS and validated by Sanger sequencing. No other mutations were found in the HBB, HBA1 and HBA2 genes by NGS and PCR analyses. The 2-bp deletion is found in the HBB region from -92 to -88 nt, which overlaps the proximal CACCC box. The β-globin gene promoter relies on the proximal CACCC box for correct regulation. The phastCons and PhyloP, which are two in silico tools for identifying evolutionarily conserved elements, showed that the sequences between -93 and -86 (CCACACCC) are highly conserved with a core sequence CACCC. The proband had normal red blood cell (RBC) indices, only with a slightly decreased red blood corpuscular volume distribution width (RDW) determined by a hematology analyzer (XN-9000, Sysmex). Hemoglobin analysis was performed by capillary electrophoresis (Capillarys 2 FIEX PIERCING, Sebia). The proband had 93.1% HbA (lower than normal), 4.2% Hb A2 and 2.7% Hb F (higher than normal).
