
IthaID: 40
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CAP +41 to +44 (-AACA) | HGVS Name: | HBB:c.-10_-7delAACA |
| Hb Name: | N/A | Protein Info: | β nts 40 - 43 deleted |
| Also known as: | CAP +40 to +43 (-AAAC) |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CACAACTGTGTTCACTAGCAACCTCA [-/AACA] GACACCATGGTGCATCTGACTCCT (Strand: -)
Comments: Found in a heterozygous state during molecular screening. In vitro experiments did not show functional effects of the genetic variant. Further investigation was suggested. Papers reported a 4 bp deletion -AAAC [HBB: c.-11_-8delAAAC], which does not follow the 3' prime rule of HGVS recommendations.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β+ |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70585 |
| Size: | 4 bp |
| Located at: | β |
| Specific Location: | 5'UTR |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | 5'UTR (Transcription) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Huang SZ, Xu YH, Zeng FY, Wu DF, Ren ZR, Zeng YT, A novel beta-thalassaemia mutation: deletion of 4 bp (-AAAC) in the 5' transcriptional sequence., British journal of haematology, 78(1), 125-6, 1991
- Francès V, Morlé F, Godet J, Functional analysis of the 4 bp deletion identified in the 5' untranslated region of one of the beta-globin genes from a Chinese beta-thalassaemic heterozygote., Br. J. Haematol. , 84(1), 163-5, 1993
Created on 2010-06-16 16:13:14,
Last reviewed on 2021-12-15 11:39:21 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.