IthaID: 4065
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 124 (-C) | HGVS Name: | HBB:c.374delC |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CATCACTTTGGCAAAGAATTCACCC [C/-] ACCAGTGCAGGCTGCCTATCAGAAA (Strand: -)
Comments: A 'C' deletion in exon 3 of HBB resulting in a frameshift and a predicted production of β-globin chains with an elongated C-terminus. Found in a heterozygous state in four affected individuals from one family, showing hypochromic microcytic anemia accompanied by increased ferritin levels and Coombs-negative hemolysis.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | Dominant |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71948 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Polish |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Novak W, Sunder-Plassmann R, Berner J, Köhrer S, Zeitlhofer P, Haas OA, Riedl J, Kager L, Sillaber C, Dominant inherited β-thalassemia intermedia in a Polish family due to a novel frameshift mutation in HBB., Pediatr Blood Cancer, 2023 PubMed
Created on 2023-08-04 11:46:44,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.