IthaID: 4085
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 132 (+T) | HGVS Name: | HBA2:c.398dup |
Hb Name: | Hb Balkh | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TCCCTGGACAAGTTCCTGGCTTCTGT [-/T] GAGCACCGTGCTGACCTCCAAATAC (Strand: +)
Comments: The c.398dup variant (CD 132 GTG>GTTG) [p.Val133fs] is a frameshift mutation in the HBA2 gene, co-inherited with the α⁺ deletional variant -α³.⁷ [IthaID: 300] in a 13-year-old boy from Balkh province, Afghanistan, who has been receiving transfusions since the age of 5. The duplication of 'T' at p.Val133 causes a frameshift, resulting in an elongated α-chain with an additional 30 amino acids (171 in total). The HGVS nomenclature was assigned based on the sequence information provided in the paper.
External Links
Phenotype
Hemoglobinopathy Group: | Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | α-chain variant |
Allele Phenotype: | N/A |
Stability: | N/A |
Oxygen Affinity: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 34432 |
Size: | 1 bp |
Located at: | α2 |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Insertion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Afghan |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Tavassoli S, Chung JH, Panigrahi AR, Shahsavar A, Lal A, Singer ST, Hemoglobin Balkh, a Novel Mutation in Codon 132 of α2-Globin Gene [α132(H15) (+T) or :C.396dup (p.Val134fs)]: A Case Report and Insight into the Pathophysiology., Hemoglobin, 48(4), 280-284, 2024 PubMed
Microattributions
A/A | Contributor(s) | Date | Comments |
---|---|---|---|
1 | Tavassoli, Shabnam | 2023-11-29 | First report. |