IthaID: 4093



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 95 (-C) HGVS Name: HBA1:c.287delC
Hb Name: Hb Campania Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TGCACGCGCACAAGCTTCGGGTGGACC [C/-] GGTCAACTTCAAGGTGAGCGGCGGGCC (Strand: +)

Comments: The C deletion at codon 95, results in a frameshift, that gives rise to a premature stop codon at position 101 leading to a truncated protein. Found in a family in Naples and both carriers showed mild α-thalassemia haematological alterations. HPLC and electrophoresis revealed no abnormal haemoglobin or globin chains. However, both qualitative and semiquantitative analyses of the mRNA from the carrier’s reticulocytes revealed a decrease in mutant mRNA constituted 34% (Hb Campania) of total α1-globin mRNA. The analyses of the 3D models indicate that the Hb Campania is unstable.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-thalassaemia, α-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37983
Size: 1 bp
Located at: α1
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Southern Italian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Cardiero G, Musollino G, Prezioso R, Lacerra G, mRNA Analysis of Frameshift Mutations with Stop Codon in the Last Exon: The Case of Hemoglobins Campania [α1 cod95 (-C)] and Sciacca [α1 cod109 (-C)]., Biomedicines, 9(10), , 2021 PubMed
Created on 2024-02-16 13:37:00, Last reviewed on 2024-02-22 09:54:08 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.