IthaID: 4093
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 95 (-C) | HGVS Name: | HBA1:c.287delC |
Hb Name: | Hb Campania | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TGCACGCGCACAAGCTTCGGGTGGACC [C/-] GGTCAACTTCAAGGTGAGCGGCGGGCC (Strand: +)
Comments: The C deletion at codon 95, results in a frameshift, that gives rise to a premature stop codon at position 101 leading to a truncated protein. Found in a family in Naples and both carriers showed mild α-thalassemia haematological alterations. HPLC and electrophoresis revealed no abnormal haemoglobin or globin chains. However, both qualitative and semiquantitative analyses of the mRNA from the carrier’s reticulocytes revealed a decrease in mutant mRNA constituted 34% (Hb Campania) of total α1-globin mRNA. The analyses of the 3D models indicate that the Hb Campania is unstable.
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia, α-chain variant |
Allele Phenotype: | N/A |
Stability: | Unstable |
Oxygen Affinity: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 37983 |
Size: | 1 bp |
Located at: | α1 |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Southern Italian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Cardiero G, Musollino G, Prezioso R, Lacerra G, mRNA Analysis of Frameshift Mutations with Stop Codon in the Last Exon: The Case of Hemoglobins Campania [α1 cod95 (-C)] and Sciacca [α1 cod109 (-C)]., Biomedicines, 9(10), , 2021 PubMed