IthaID: 4094
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 54 GTT>-TT | HGVS Name: | HBB:c.163del |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TGGGGATCTGTCCACTCCTGATGCT [G/-] TTATGGGCAACCCTAAGGTGAAGG (Strand: -)
Comments: Frameshift variant co-inherited with Hb E in a 21 year-old individual with a thalassemia intermedia type of clinical manifestation and with more than 70 transfusions. The deletion of 'G' at position c.163 generates a premature stop codon after seven codons, leading to a truncated protein. Assumed de novo as it was not detected in the father, mother and siblings.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70887 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Mamata M, Padma G, Pragna Laxmi T, Saroja K, Ashwin D, Suman J, Identification of a Novel Variant in Gene Resulting in a Beta Null Phenotype in a Proband with Thalassemia Intermedia., Hemoglobin, 2024
Created on 2024-02-21 13:01:42,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.