IthaID: 4135
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | -57 A>C | HGVS Name: | HBB:c.-107A>C |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGGTTGGCCAATCTACTCCCAGGAGC [A>C] GGGAGGGCAGGAGCCAGGGCTGGGC (Strand: -)
Comments: The c.-107A>C variant is found in the promoter region of the HBB gene. It was identified in the heterozygous state with an MCV of 80.4 fL and an MCH of 22.4 pg/cell. It was detected as part of thalassemia gene testing using flow-through hybridization and gene chip (FHGC) technology and/or electrophoretic and sequencing methods.
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70488 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Promoter |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Promoter (Transcription) |
Ethnic Origin: | Chinese |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Zhao X, You Z, Deng Y, Zhou Y, Deng D, Quan J, Chen F, Yan Z, Qi Y, Chen L, Xiang F, Zheng W, Zhang R, The distribution and spectrum of thalassemia variants in GUIYANG region, southern China., Orphanet J Rare Dis, 20(1), 56, 2025 PubMed
Created on 2025-03-12 12:53:35,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.