
IthaID: 416
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 131 (+T) >175aa | HGVS Name: | HBA1:c.396dup |
| Hb Name: | Hb Pak Num Po | Protein Info: | α1 131(+T); modified C-terminal sequence: (132)Cys-Glu-His-Arg-Ala-Asp-Leu-Gln- Ile-Pro-Leu-Ser-Trp-Ser-Leu-Gly-Gly-His- Ala-Ser-Cys-Pro-Leu-Gly-Leu-Pro-Pro-Ala- Pro-Pro-Pro-Leu-Pro-Ala-Pro-Val-Pro-Pro- Trp-Ser-Leu-Asn-Lys-(175)Val-COOH |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CTCCCTGGACAAGTTCCTGGCTTCT [-/T] GTGAGCACCGTGCTGACCTCCAAAT (Strand: +)
Comments: Found in compound heterozygosity with the –SEA deletion [IthaID:309] leading to Hb H disease. Also, patient with Hb Pak Num Po and the deletional mutation -α4.2 [IthaID:301] presented with mild hypochromic microcytic anemia and required no blood transfusions.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia, α-chain variant |
| Allele Phenotype: | α⁺ |
| Stability: | Hyperunstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 38241 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Thai |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Viprakasit V, Tanphaichitr VS, Veerakul G, Chinchang W, Petrarat S, Pung-Amritt P, Higgs DR, Co-inheritance of Hb Pak Num Po, a novel alpha1 gene mutation, and alpha0 thalassemia associated with transfusion-dependent Hb H disease., American journal of hematology, 75(3), 157-63, 2004
- Sanpakit K, Viprakasit V, Variable genotype-phenotype correlations in patients with a rare nondeletional α-thalassemia; Hb Pak Num Po (HBA1: c.396_397insT)., J Pediatr Hematol Oncol, 36(3), e185-9, 2014
Created on 2010-06-16 16:13:15,
Last reviewed on 2022-02-28 09:18:20 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.