IthaID: 4182
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 61 (+AAG) [+Lys] | HGVS Name: | HBB:c.184_186dupAAG |
| Hb Name: | Hb Chaiyaphum | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TGCTGTTATGGGCAACCCTAAGGTG [AAG/AAGAAG] CTCATGGCAAGAAAGTGCTCGGTGC (Strand: -)
Comments: Identified in a 10-year-old girl in association with Hb E [IthaID: 88]. The patient presented with anaemia and hypersplenism requiring splenectomy, along with low oxygen saturation. Haemoglobin analysis demonstrated reduced Hb A, elevated Hb A₂ and Hb F levels, Hb E at 30.3%, and an additional Hb variant at 7%. Her father, heterozygous for Hb Chaiyaphum, had a history of thalassaemia, splenectomy, and low oxygen saturation. Similar clinical features were observed in her paternal grandfather, supporting the characterization of the variant as dominant.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
| Allele Phenotype: | β+ |
| Stability: | N/A |
| Oxygen Affinity: | Decreased Oxygen Affinity |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70908 |
| Size: | 3 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
| Ethnic Origin: | Thai |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Singha, Kritsada | 2025-02-28 | First report. |
| 2 | Wongprachum, Kasama | 2025-02-28 | First report. |
| 3 | Fucharoen, Supan | 2026-02-28 | First report. |