IthaID: 4182



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 61 (+AAG) [+Lys] HGVS Name: HBB:c.184_186dupAAG
Hb Name: Hb Chaiyaphum Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TGCTGTTATGGGCAACCCTAAGGTG [AAG/AAGAAG] CTCATGGCAAGAAAGTGCTCGGTGC (Strand: -)

Comments: Identified in a 10-year-old girl in association with Hb E [IthaID: 88]. The patient presented with anaemia and hypersplenism requiring splenectomy, along with low oxygen saturation. Haemoglobin analysis demonstrated reduced Hb A, elevated Hb A₂ and Hb F levels, Hb E at 30.3%, and an additional Hb variant at 7%. Her father, heterozygous for Hb Chaiyaphum, had a history of thalassaemia, splenectomy, and low oxygen saturation. Similar clinical features were observed in her paternal grandfather, supporting the characterization of the variant as dominant.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:β+
Stability: N/A
Oxygen Affinity: Decreased Oxygen Affinity
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70908
Size: 3 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Thai
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Singha, Kritsada 2025-02-28First report.
2Wongprachum, Kasama2025-02-28First report.
3Fucharoen, Supan2026-02-28First report.
Created on 2026-04-15 13:08:54, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.