IthaID: 611



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 74/75 -GAC [-Asp] HGVS Name: HBA2:c.226_228delGAC
Hb Name: Hb Watts Protein Info: α2 74(EF3) Asp->0 OR α2 75(EF4) Asp->0

Context nucleotide sequence:
GACCAACGCCGTGGCGCACGTGGAC [-/GAC] ATGCCCAACGCGCTGTCCGCCCTGA (Strand: +)

Also known as:

Comments: Initially detected in a Mexican-American heterozygous trait individual (F/37) without apparent haematological manifestations (13.7 g/dL Hb, 83.5 fL MCV, 2.3% HbA2, 0.5% HbF). Electrophoresis on cellulose acetate at pH 8.6, as well as IEF, revealed an abnormal Hb band with the same mobility as Hb S. The concentration of the variant was 9.8% as determined by HPLC. Unstable variant as detected by isopropanol stability testing after 20 minutes of incubation. Detected in a Spanish asymptomatic individual (F/58) together with an intronic insertion in HBD gene. Normal haematological indices (15.4 g/dL Hb, 90.3 fl MCV, 27.5 pg MCH, 1.7% HbA2, 0.6% HbF), as well as normal peripheral blood smear and ferric metabolism. Abnormal Hb was observed on capillary zone electrophoresis in Z6 and as a slower peak than HbA at a retention time of 4.19 min by cation-exchange HPLC. Co-inherited with an HBD intronic variant.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-thalassaemia, α-chain variant
Allele Phenotype:α⁺
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34118
Size: 3 bp
Located at: α2
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Mexican-American, Spanish
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Rahbar S, Lee C, Fáirbanks VF, McCormick DJ, Kubik K, Madden BJ, Nozari G, Hb Watts [alpha 74(EF3) or alpha 75(EF4)Asp-->0]: a shortened alpha chain variant due to the deletion of three nucleotides in exon 2 of the alpha 2-globin gene., Hemoglobin, 21(4), 321-30, 1997 PubMed
  2. González Borrachero ML, de la Fuente-Gonzalo F, González FA, Nieto JM, Villegas A, Ropero P, [Delta⁰-thalassemia by insertion of 27 base pairs in δ-globin gene with decreased hemoglobin A₂ levels]., Med Clin (Barc) , 144(7), 312-6, 2015 PubMed
Created on 2010-06-16 16:13:16, Last reviewed on 2021-08-11 11:11:19 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.