IthaID: 611
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 74/75 -GAC [-Asp] | HGVS Name: | HBA2:c.226_228delGAC |
Hb Name: | Hb Watts | Protein Info: | α2 74(EF3) Asp->0 OR α2 75(EF4) Asp->0 |
Context nucleotide sequence:
GACCAACGCCGTGGCGCACGTGGAC [-/GAC] ATGCCCAACGCGCTGTCCGCCCTGA (Strand: +)
Also known as:
Comments: Initially detected in a Mexican-American heterozygous trait individual (F/37) without apparent haematological manifestations (13.7 g/dL Hb, 83.5 fL MCV, 2.3% HbA2, 0.5% HbF). Electrophoresis on cellulose acetate at pH 8.6, as well as IEF, revealed an abnormal Hb band with the same mobility as Hb S. The concentration of the variant was 9.8% as determined by HPLC. Unstable variant as detected by isopropanol stability testing after 20 minutes of incubation. Detected in a Spanish asymptomatic individual (F/58) together with an intronic insertion in HBD gene. Normal haematological indices (15.4 g/dL Hb, 90.3 fl MCV, 27.5 pg MCH, 1.7% HbA2, 0.6% HbF), as well as normal peripheral blood smear and ferric metabolism. Abnormal Hb was observed on capillary zone electrophoresis in Z6 and as a slower peak than HbA at a retention time of 4.19 min by cation-exchange HPLC. Co-inherited with an HBD intronic variant.
Phenotype
Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia, α-chain variant |
Allele Phenotype: | α⁺ |
Stability: | Unstable |
Oxygen Affinity: | N/A |
Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 34118 |
Size: | 3 bp |
Located at: | α2 |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
Ethnic Origin: | Mexican-American, Spanish |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Rahbar S, Lee C, Fáirbanks VF, McCormick DJ, Kubik K, Madden BJ, Nozari G, Hb Watts [alpha 74(EF3) or alpha 75(EF4)Asp-->0]: a shortened alpha chain variant due to the deletion of three nucleotides in exon 2 of the alpha 2-globin gene., Hemoglobin, 21(4), 321-30, 1997 PubMed
- González Borrachero ML, de la Fuente-Gonzalo F, González FA, Nieto JM, Villegas A, Ropero P, [Delta⁰-thalassemia by insertion of 27 base pairs in δ-globin gene with decreased hemoglobin A₂ levels]., Med Clin (Barc) , 144(7), 312-6, 2015 PubMed
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:16 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
3 | 2020-08-10 12:35:28 | The IthaGenes Curation Team | Reviewed. Origin and Reference added. |
4 | 2021-08-11 11:11:19 | The IthaGenes Curation Team | Reviewed. Comment added, Variation info updated. |