IthaID: 724



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 119/120 +ATC [+Ile] HGVS Name: HBA1:c.354_355insATC
Hb Name: Hb Phnom Penh Protein Info: I- inserted between codons 117(GH5) and 118(H1) of α1
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CCGCCCACCTCCCCGCCGAGTTC [-/ATC] ACCCCTGCGGTGCACGCCTCCCT (Strand: +)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-thalassaemia, α-chain variant
Allele Phenotype:α⁺
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 38200
Size: 3 bp
Located at: α1
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Chinese, Cambodian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Zhai YS, Tang HS, Zhou JY, Li DZ, A novel case of Hb Phnom Penh: codons 117/118 (+ATC) as a cause of α+ -thalassemia., Hemoglobin , 36(3), 289-92, 2012 PubMed
Created on 2010-06-16 16:13:16, Last reviewed on 2025-09-10 13:03:46 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.