IthaID: 8
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | -88 (C>T) | HGVS Name: | HBB:c.-138C>T |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TTAGACCTCACCCTGTGGAGCCACA [A/C/G/T] CCTAGGGTTGGCCAATCTACTCCCA (Strand: -)
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β++ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70457 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | African-American, Asian Indians, Pakistani |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Orkin SH, Antonarakis SE, Kazazian HH, Base substitution at position -88 in a beta-thalassemic globin gene. Further evidence for the role of distal promoter element ACACCC., The Journal of biological chemistry, 259(14), 8679-81, 1984
- Thein SL, Hesketh C, Wallace RB, Weatherall DJ, The molecular basis of thalassaemia major and thalassaemia intermedia in Asian Indians: application to prenatal diagnosis., British journal of haematology, 70(2), 225-31, 1988
- Yasmeen H, Toma S, Killeen N, Hasnain S, Foroni L, The molecular characterization of Beta globin gene in thalassemia patients reveals rare and a novel mutations in Pakistani population., Eur J Med Genet , 59(8), 355-62, 2016
Created on 2010-06-16 16:13:14,
Last reviewed on 2016-09-02 14:07:42 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.