IthaID: 101

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	IVS I-1 G>A	HGVS Name:	HBB:c.92+1G>A
Hb Name:	N/A	Protein Info:	β nt 143 G>A

Context nucleotide sequence:
AAGTTGGTGGTGAGGCCCTGGGCAG [A/G/T] TTGGTATCAAGGTTACAAGACAGGT (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

HbVar	dbSNP
OMIM	LOVD
ClinVar

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	β-thalassaemia
Allele Phenotype:	β0
Associated Phenotypes:	Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	70687
Size:	1 bp
Located at:	β
Specific Location:	Intron 1

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	Splice junction (mRNA Processing)
Ethnic Origin:	Mediterranean
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

Orkin SH, Kazazian HH, Antonarakis SE, Goff SC, Boehm CD, Sexton JP, Waber PG, Giardina PJ, Linkage of beta-thalassaemia mutations and beta-globin gene polymorphisms with DNA polymorphisms in human beta-globin gene cluster., Nature, 296(5858), 627-31, 1982 PubMed
Oner R, Altay C, Gurgey A, Aksoy M, Kilinç Y, Stoming TA, Reese AL, Kutlar A, Kutlar F, Huisman TH, Beta-thalassemia in Turkey., Hemoglobin, 14(1), 1-13, 1990 PubMed
Baysal E, Indrak K, Bozkurt G, Berkalp A, Aritkan E, Old JM, Ioannou P, Angastiniotis M, Droushiotou A, Yüregir GT, The beta-thalassaemia mutations in the population of Cyprus., British journal of haematology, 81(4), 607-9, 1992 PubMed
Benito A, Villegas A, Perez-Cano R, Bernal R, Beta-thalassaemia in south-western Spain: high frequency of G-->A (IVS I-1) mutation., Br. J. Haematol. , 92(2), 336-8, 1996 PubMed

Created on 2010-06-16 16:13:14, Last reviewed on 2014-05-14 16:42:45 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:14	The IthaGenes Curation Team	Created
2	2013-10-15 17:28:32	The IthaGenes Curation Team	Reviewed.
3	2014-05-14 16:42:45	The IthaGenes Curation Team	Reviewed. Additional references and ClinVar link added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.