IthaID: 111



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS I-6 (T>C) HGVS Name: HBB:c.92+6T>C
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GGTGGTGAGGCCCTGGGCAGGTTGG [T/C] ATCAAGGTTACAAGACAGGTTTAAG (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70692
Size: 1 bp
Located at: β
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Consensus splice site (mRNA Processing)
Ethnic Origin: Mediterranean, Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Orkin SH, Kazazian HH, Antonarakis SE, Goff SC, Boehm CD, Sexton JP, Waber PG, Giardina PJ, Linkage of beta-thalassaemia mutations and beta-globin gene polymorphisms with DNA polymorphisms in human beta-globin gene cluster., Nature, 296(5858), 627-31, 1982 PubMed
  2. Tamagnini GP, Lopes MC, Castanheira ME, Wainscoat JS, Wood WG, Beta + thalassemia--Portuguese type: clinical, haematological and molecular studies of a newly defined form of beta thalassaemia., British journal of haematology, 54(2), 189-200, 1983 PubMed
  3. Chen B, Huang P, Yi S, Chen Q, Tang Y, Zhang Q, He S, First Detection of a Splice Site β-Thalassemia Mutation, IVS-I-6 (T > C) (HBB: c.92 + 6T > C) in a Chinese Family., Hemoglobin, 39(3), 207-8, 2015 PubMed
Created on 2010-06-16 16:13:14, Last reviewed on 2022-06-03 13:37:55 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.