IthaID: 111
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | IVS I-6 (T>C) | HGVS Name: | HBB:c.92+6T>C |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGTGGTGAGGCCCTGGGCAGGTTGG [T/C] ATCAAGGTTACAAGACAGGTTTAAG (Strand: -)
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β+ |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70692 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Consensus splice site (mRNA Processing) |
Ethnic Origin: | Mediterranean, Chinese |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Frequencies
Publications / Origin
- Orkin SH, Kazazian HH, Antonarakis SE, Goff SC, Boehm CD, Sexton JP, Waber PG, Giardina PJ, Linkage of beta-thalassaemia mutations and beta-globin gene polymorphisms with DNA polymorphisms in human beta-globin gene cluster., Nature, 296(5858), 627-31, 1982 PubMed
- Tamagnini GP, Lopes MC, Castanheira ME, Wainscoat JS, Wood WG, Beta + thalassemia--Portuguese type: clinical, haematological and molecular studies of a newly defined form of beta thalassaemia., British journal of haematology, 54(2), 189-200, 1983 PubMed
- Chen B, Huang P, Yi S, Chen Q, Tang Y, Zhang Q, He S, First Detection of a Splice Site β-Thalassemia Mutation, IVS-I-6 (T > C) (HBB: c.92 + 6T > C) in a Chinese Family., Hemoglobin, 39(3), 207-8, 2015 PubMed
Created on 2010-06-16 16:13:14,
Last reviewed on 2022-06-03 13:37:55 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.