IthaID: 193
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic | 
|---|---|---|---|
| Common Name: | CD 91 CTG>C-G | HGVS Name: | HBB:c.275del | 
| Hb Name: | Hb Morgantown | Protein Info: | β 91 (-T); modified C-terminal sequence | 
| Also known as: | 
We follow the 
						 
							HGVS sequence variant nomenclature
						
						and
						 
							 IUPAC standards.
						
					
					
					
Context nucleotide sequence:
GGCACCTTTGCCACACTGAGTGAGC [-/T] GCACTGTGACAAGCTGCACGTGGAT  (Strand: -)
Comments: Hb Morgantown, causes a frame shift in the coding DNA sequence and results in a variant beta-globin chain with 156 amino acid residues before it is terminated by an in frame TAA termination codon. The amino acids from codon 91 till the carboxyl-end are entirely different from those of a normal beta-globin chain, which has 146 amino acids.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy | 
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant | 
| Allele Phenotype: | Dominant | 
| Stability: | N/A | 
| Oxygen Affinity: | N/A | 
| Associated Phenotypes: | 
							Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972]  | 
					
Location
| Chromosome: | 11 | 
|---|---|
| Locus: | NG_000007.3 | 
| Locus Location: | 70999 | 
| Size: | 1 bp | 
| Located at: | β | 
| Specific Location: | Exon 2 | 
Other details
| Type of Mutation: | Point-Mutation(Deletion) | 
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) | 
| Ethnic Origin: | Irish | 
| Molecular mechanism: | N/A | 
| Inheritance: | Dominant | 
| DNA Sequence Determined: | No | 
In silico pathogenicity prediction
Sequence Viewer
								 Note:  The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
								Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
								In such a case, please Refresh the page or retry at a later stage.
								Otherwise, use this external link.
							
							
						Publications / Origin
- Luo HY, Tang W, Eung SH, Coad JE, Canfield P, Keller F, Crowell EH, Steinberg MH, Chui DH, Dominantly inherited beta thalassaemia intermedia caused by a new single nucleotide deletion in exon 2 of the beta globin gene: Hb morgantown (beta91 CTG>CG)., Journal of clinical pathology, 58(10), 1110-2, 2005 PubMed
 
					Created on 2010-06-16 16:13:15,
					Last reviewed on 2014-04-08 13:05:43					(Show full history)
				
				
			
 Disclaimer: The information on this website is provided as an information resource only
    and must not to be used as a substitute for professional diagnosis and treatment.
    The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
    diagnosis or any other information, services or products that an individual obtains through this website.