
IthaID: 200
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | IVS II-1 G>A | HGVS Name: | HBB:c.315+1G>A |
Hb Name: | N/A | Protein Info: | β nt 496 G>T |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GCACGTGGATCCTGAGAACTTCAGG [A/C/G/T] TGAGTCTATGGGACGCTTGATGTTT (Strand: -)
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β0 |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 71040 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Intron 2 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Splice junction (mRNA Processing) |
Ethnic Origin: | Mediterranean, African-American, Pakistani |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Baird M, Driscoll C, Schreiner H, Sciarratta GV, Sansone G, Niazi G, Ramirez F, Bank A, A nucleotide change at a splice junction in the human beta-globin gene is associated with beta 0-thalassemia., Proceedings of the National Academy of Sciences of the United States of America, 78(7), 4218-21, 1981
- Treisman R, Proudfoot NJ, Shander M, Maniatis T, A single-base change at a splice site in a beta 0-thalassemic gene causes abnormal RNA splicing., Cell, 29(3), 903-11, 1982
- Yasmeen H, Toma S, Killeen N, Hasnain S, Foroni L, The molecular characterization of Beta globin gene in thalassemia patients reveals rare and a novel mutations in Pakistani population., Eur J Med Genet , 59(8), 355-62, 2016
Created on 2010-06-16 16:13:15,
Last reviewed on 2016-09-02 14:10:18 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.