IthaID: 238



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 114 (-CT, +G) >156aa HGVS Name: HBB:c.343_344delinsG
Hb Name: Hb Geneva Protein Info: β 114 (-CT); modified C-terminal sequence AND β 114(+G); modified C-terminal sequence

Context nucleotide sequence:
CCTGGGCAACGTGCTGGTCTGTGTG [CT/G] GGCCCATCACTTTGGCAAAGAATTC (Strand: -)

Also known as:

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Thalassaemia dominant
Dominant
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71917
Size: 2 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Swiss-French, Swiss
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Beris P, Miescher PA, Diaz-Chico JC, Han IS, Kutlar A, Hu H, Wilson JB, Huisman TH, Inclusion body beta-thalassemia trait in a Swiss family is caused by an abnormal hemoglobin (Geneva) with an altered and extended beta chain carboxy-terminus due to a modification in codon beta 114., Blood, 72(2), 801-5, 1988 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2013-10-15 17:00:14 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.