IthaID: 24

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: -29 to -26 (-AA) HGVS Name: HBB:c.-79_-78delAA
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GAGGGCAGGAGCCAGGGCTGGGCAT [AA/-] AAGTCAGGGCAGAGCCATCTATTGC (Strand: -)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70516
Size: 2 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: African-American
Molecular mechanism: TATAA box (HBB)
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Basran RK, Reiss UM, Luo HY, Ware RE, Chui DH, Beta-thalassemia intermedia due to compound heterozygosity for two beta-globin gene promoter mutations, including a novel TATA box deletion., Pediatric blood & cancer, 50(2), 363-6, 2008
Created on 2010-06-16 16:13:14, Last reviewed on 2026-05-18 12:43:03 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.