IthaID: 269
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | 3'UTR -13 bp [CAP +1567 to +1579] | HGVS Name: | HBB:c.*93_*105delATCTGGATTCTGC |
| Hb Name: | N/A | Protein Info: | β nts 1565 - 1577 deleted |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ATATTATGAAGGGCCTTGAGC [-/ATCTGGATTCTGC] CTAATAAAAAACATTTATTTTCA (Strand: -)
Comments: Found in two members of a family; in a heterozygous state in the mother and in combination with a β+ mutation in a patient with transfusion-dependent thalassaemia. Reported in literature as HBB:c.*91_*103delGCATCTGGATTCT, which does not follow the HGVS Sequence Variant Nomeclature guidelines.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β+ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72111 |
| Size: | 13 bp |
| Located at: | β |
| Specific Location: | 3'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Other 3'UTR site (mRNA Processing) |
| Ethnic Origin: | Turkish |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Frequencies
Publications / Origin
- Başak AN, Ozer A, Kirdar B, Akar N, A novel 13 Bp deletion in the 3'UTR of the beta-globin gene causes beta-thalassemia in a Turkish patient., Hemoglobin, 17(6), 551-5, 1993 PubMed
Created on 2010-06-16 16:13:15,
Last reviewed on 2019-11-11 12:39:27 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.