IthaID: 276



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: Poly A (A>G) AATAAA>AATAAG HGVS Name: HBB:c.*113A>G
Hb Name: N/A Protein Info: β nt 1587 A>G

Context nucleotide sequence:
TGAGCATCTGGATTCTGCCTAATAA [A/G] AAACATTTATTTTCATTGCAATGAT (Strand: -)

Also known as:

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72131
Size: 1 bp
Located at: β
Specific Location: 3'UTR, Poly(A)

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: RNA cleavage - Poly(A) signal (mRNA Processing)
Ethnic Origin: Kurdish
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Rund D, Filon D, Dowling C, Kazazian HH, Rachmilewitz EA, Oppenheim A, Molecular studies of beta-thalassemia in Israel. Mutational analysis and expression studies., Ann. N. Y. Acad. Sci. , 612(0), 98-105, 1990 PubMed
  2. Rund D, Cohen T, Filon D, Dowling CE, Warren TC, Barak I, Rachmilewitz E, Kazazian HH, Oppenheim A, Evolution of a genetic disease in an ethnic isolate: beta-thalassemia in the Jews of Kurdistan., Proceedings of the National Academy of Sciences of the United States of America, 88(1), 310-4, 1991 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2023-01-10 09:33:21 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.