
IthaID: 278
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | Poly A (-AATAA) | HGVS Name: | HBB:c.*110_*114del |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: | polyA (-TAAAA) |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGGCCTTGAGCATCTGGATTCTGCCTAA [-/TAAAA] AACATTTATTTTCATTGCAATGATGT (Strand: -)
Comments: A 5 bp deletion of the polyA signal sequence (AATAAA>A). Found in a homozygous state in an Arab child from Gaza and in a proband from Egypt, both with transfusion-dependent β-thalassaemia major. Found as a compound heterozygote with Hb S in a proband from Nigeria.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β+ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72128 |
| Size: | 5 bp |
| Located at: | β |
| Specific Location: | 3'UTR, Poly(A) |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | RNA cleavage - Poly(A) signal (mRNA Processing) |
| Ethnic Origin: | Arab/Palestinian, Egyptian, Nigerian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Rund D, Dowling C, Najjar K, Rachmilewitz EA, Kazazian HH, Oppenheim A, Two mutations in the beta-globin polyadenylylation signal reveal extended transcripts and new RNA polyadenylylation sites., Proceedings of the National Academy of Sciences of the United States of America, 89(10), 4324-8, 1992
- el-Kalla S, Mathews AR, A significant beta-thalassemia heterogeneity in the United Arab Emirates., Hemoglobin, 21(3), 237-47, 1997
- Lacan P, Ponceau B, Aubry M, Francina A, Mild Hb S-beta(+)-thalassemia with a deletion of five nucleotides at the polyadenylation site of the beta-globin gene., Hemoglobin, 27(4), 257-9, 2003
Created on 2010-06-16 16:13:15,
Last reviewed on 2020-10-02 10:21:09 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.