IthaID: 281

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: IVS I [3 end] -44 bp HGVS Name: HBB:c.76_92+27del
Hb Name: N/A Protein Info: N/A
Also known as: 44 bp deletion

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CAAGGTGAACGTGGATGAAGTTGGT [-/GGTGAGGC] TAAGGAGACCAATAGAAACTGGGCA (Strand: -)

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70670
Size: 44 bp
Deletion involves: β

Other details

Type of Mutation: Deletion
Ethnic Origin: Greek, Macedonian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Breakpoint Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Gonzalez-Redondo JM, Kattamis C, Huisman TH, Characterization of three types of beta zero-thalassemia resulting from a partial deletion of the beta-globin gene., Hemoglobin, 13(4), 377-92, 1989
Created on 2010-06-16 16:13:15, Last reviewed on 2013-10-15 17:28:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.