
IthaID: 2958
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 7/8 (+G) | HGVS Name: | HBB:c.24dupG |
Hb Name: | N/A | Protein Info: | β 8(+G); modified C-terminal sequence: (8)Glu-Val-Cys-Arg-Tyr-Cys-Pro-Val-Gly-Gln-Gly-Glu-Arg-Gly-(22)COOH |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGTGCATCTGACTCCTGAGGAG [-/G] AAGTCTGCCGTTACTGCCCTGT (Strand: -)
Comments: The mutation causes a shift of the open globin reading frame, which leads to the development of a terminal codon in codon 22. The thalassaemic allele is associated with the mediterranean haplotype IX. The mutation presents with beta0-thalassaemia minor and slightly elevated HbF.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β0 |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70618 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 1 |
Other details
Type of Mutation: | Point-Mutation(Insertion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Slovakian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Kynclová E, Divoký V, Kovaríková L, Melichárková R, Indráková J, Divoká M, Hammerová T, Sakalová A, Hudecek J, Indrák K, [New beta0-thalassaemic insertion mutation (CD 7/8, +G) in a Slovak family, associated with the Mediterranean haplotype IX]., Vnitr Lek , 45(3), 151-4, 1999
- Divoka M, Partschova M, Kucerova J, Mojzikova R, Cermak J, Pospisilova D, Fabryova V, Prochazkova D, Indrak K, Divoky V, Molecular Characterization of β-Thalassemia in the Czech and Slovak Populations: Mediterranean, Asian and Unique Mutations., Hemoglobin , 40(3), 156-62, 2016
Created on 2016-08-23 11:50:36,
Last reviewed on 2019-11-12 16:20:42 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.