IthaID: 3227
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 125-126 (+CCAGT) | HGVS Name: | HBB:c.376_380dupCCAGT |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
TGGCAAAGAATTCACCCCACCAGT [-/CCAGT] GCAGGCTGCCTATCAGAAAGTGG (Strand: -)
Also known as:
Comments: Found as a heterozygote with a thalassemia intermedia phenotype and a dominant transmission pattern. Frameshift mutation that creates a novel transcription termination site at position 159 (vs. native stop codon at position 147), generating a slightly longer protein with unnatural C-terminus. The mutant version of mRNA was not detectable.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
Allele Phenotype: | N/A |
Stability: | N/A |
Oxygen Affinity: | N/A |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 71950 |
Size: | 5 bp |
Located at: | β |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Insertion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Polish |
Molecular mechanism: | Altered α1β1 interface |
Inheritance: | Dominant |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Rawa K, Szczesny RJ, Owczarek EP, Adamowicz-Salach A, Klukowska A, Demkow U, Plochocka D, Szczesny P, Gora M, Dziembowski A, Burzynska B, Two novel C-terminal frameshift mutations in the β-globin gene lead to rapid mRNA decay., BMC Med. Genet. , 18(1), 65, 2017 PubMed
Created on 2017-07-11 13:18:22,
Last reviewed on 2019-11-12 15:14:57 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2017-07-11 13:18:22 | The IthaGenes Curation Team | Created |
2 | 2019-11-12 15:14:57 | The IthaGenes Curation Team | Reviewed. Mutation names and Location corrected. Allele and Context sequence added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-24 11:43:02